MirGeneDB

MirGeneDB ID

Cli-Mir-9633

Family name MIR-9633 (all species)
Seed GAGGAUG
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-9633
Paralogues
Orthologues
Node of Origin (locus) C. livia
Node of Origin (family) C. livia
Genome context
(colLiv2)
scaffold87: 761143-761206 [-]
Precursor
(pre-Mir +30nt flank)
GCCUGGCAGCAGCUCCGGGGCUCCACAUGCAGAGGAUGGAGCUGAAUGGGAUUUUGCUGCCUGAAAUGGUCCCAUCCAGCCCCAGUCCUGCUGCACGGGGAGGCAGAUGAGUGUGUGCUUGCCU
Get precursor sequence
Structure
        10        20          30          40        50        60
GCCUGGCAGCAGCUCCGGGG--    ACA     -    -|  A    A      UUUUGCUG 
                      CUCC   UGCAG AGGA UGG GCUG AUGGGA        C
                      GAGG   ACGUC UCCU ACC CGAC UACCCU        C
UCCGUUCGUGUGUGAGUAGACG    GGC     G    G^  C    C      GGUAAAGU 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Cli-Mir-9633_5p

MirBase accessionMIMAT0038757
Sequence
0- AGAGGAUGGAGCUGAAUGGGA -21
Get sequence
Star sequence

Cli-Mir-9633_3p*

MirBase accessionMIMAT0038758
Sequence
41- CCAUCCAGCCCCAGUCCUGCUGC -64
Get sequence