MirGeneDB

MirGeneDB ID

Cli-Mir-9625

Family name MIR-9625 (all species)
Seed UGUCGGA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-9625
Paralogues
Orthologues
Node of Origin (locus) C. livia
Node of Origin (family) C. livia
Genome context
(colLiv2)
scaffold693: 1982645-1982702 [-]
Precursor
(pre-Mir +30nt flank)
CUCAGCCAGCAGCUGUUGAGAGCAUCGGAGCUGUCGGAGCCGAUGUUCUAGCUGGAAUGAAAAACGGCUGACGCUGGCACCGAGAGCCCUGUGGCUUCCAAAGACACCCUGGGACCAG
Get precursor sequence
Structure
        10          20        30        40        50         
CUCAGCCAGCAGCUGUU--|AG   AU   A   G    A    A    CU    GGAAU 
                   G  AGC  CGG GCU UCGG GCCG UGUU  AGCU     G
                   C  UCG  GUC CGA AGCC CGGU GCAG  UCGG     A
GACCAGGGUCCCACAGAAA^CU   GU   C   G    A    C    --    CAAAA 
      110       100        90        80        70          60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-9625_5p

MirBase accessionMIMAT0038741
Sequence
0- CUGUCGGAGCCGAUGUUCUAGCU -23
Get sequence
Star sequence

Cli-Mir-9625_3p*

MirBase accessionMIMAT0038742
Sequence
37- CUGACGCUGGCACCGAGAGCC -58
Get sequence