MirGeneDB

MirGeneDB ID

Cli-Mir-9621

Family name MIR-9621 (all species)
Seed CCCGUUG
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-9621
Paralogues
Orthologues
Node of Origin (locus) C. livia
Node of Origin (family) C. livia
Genome context
(colLiv2)
scaffold123: 6395738-6395795 [-]
Precursor
(pre-Mir +30nt flank)
UCUCGUCGGGAUACCUCCCAUCAGGAUACAUCCCGUUGGGAUGCAUUCUGUCAGAAUGCACCUCAUCAGGAUACAUCCCAUCGGGAUGCACCCCAUGGGGCAGCUCCCAGCUGUAGCA
Get precursor sequence
Structure
        10           20        30        40        50        
UCUCGUCGGGAUACCUC---|   CA  AUA       U       C      UCAGAAU 
                    CCAU  GG   CAUCCCG UGGGAUG AUUCUG       G
                    GGUA  CC   GUAGGGC ACCCUAC UAGGAC       C
ACGAUGUCGACCCUCGACGG^   CC  AC-       U       A      UACUCCA 
      110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-9621_5p

MirBase accessionMIMAT0038731
Sequence
0- UCCCGUUGGGAUGCAUUCUGUC -22
Get sequence
Star sequence

Cli-Mir-9621_3p*

MirBase accessionMIMAT0038732
Sequence
36- CAGGAUACAUCCCAUCGGGAUG -58
Get sequence