MirGeneDB

MirGeneDB ID

Cin-Mir-4037

Family name MIR-4037 (all species)
Seed CAAUUGC
Species Sea Squirt (Ciona intestinalis)
MiRBase ID cin-mir-4037
Paralogues
Orthologues
Node of Origin (locus) C. intestinalis
Node of Origin (family) C. intestinalis
Genome context
(ci3)
HT001175.1: 12218-12275 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-4037)
Mir-4052 HT001175.1: 12120-12173 [-] UCSC Ensembl
Mir-4037 HT001175.1: 12218-12275 [-] UCSC Ensembl
Mir-4061 HT001175.1: 12325-12379 [-] UCSC Ensembl
Mir-4039 HT001175.1: 12444-12495 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCGUGCUGUAUUAUGUCGUCAUACACGAGAACAAUUGCACUCGUCUGUACCGCCCCCAUGCGGAUGGCGGACAACGAUGGCAAUGCUCCCGUGGUGGCGCUAUUCAUCGUUUAAUUUU
Get precursor sequence
Structure
        10           20        30        40        50          
UCGUGCUGUAUUAUGUC---|    A    A  ACA     AC    C   A     CCCAU 
                    GUCAU CACG GA   AUUGC  UCGU UGU CCGCC     \
                    CGGUG GUGC CU   UAACG  AGCA ACA GGCGG     G
UUUUAAUUUGCUACUUAUCG^    -    C  CG-     GU    -   -     UAGGC 
      110       100         90         80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Cr Cr Cr Cr Cr Cr Cr Cr Cr Cr Ga La La
Mature sequence

Cin-Mir-4037_5p

MirBase accessionMIMAT0016563
Sequence
0- ACAAUUGCACUCGUCUGUACCGCC -24
Get sequence
Star sequence

Cin-Mir-4037_3p*

MirBase accessionMIMAT0016564
Sequence
37- CGGACAACGAUGGCAAUGCUC -58
Get sequence