MirGeneDB

MirGeneDB ID

Cbr-Mir-7594-P1a

Family name MIR-7594 (all species)
Seed GAGGUAG
Species Roundworm (Caenorhabditis briggsae)
MiRBase ID cbr-mir-7594a-1
Paralogues Cbr-Mir-7594-P1b  Cbr-Mir-7594-P2a  Cbr-Mir-7594-P2b 
Orthologues
Node of Origin (locus) C. briggsae
Node of Origin (family) C. briggsae
Genome context
(CB4)
X: 11731112-11731174 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-7594-P1a)
Mir-7594-P1b X: 11722778-11722840 [+] Ensembl
Mir-7594-P1a X: 11731112-11731174 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UACUAUUCCUGAAACCGUUGCUAUGUAUUUUCGGGUUUCAUCGUCGCCCUCGACACUCACAGCGAAGUGUUGAGGUAGGCAUGUAGCCCGAAAACAAAUAUGUCAACGGACCCUUGAAAUGGG
Get precursor sequence
Structure
        10        20          30        40        50        60 
UACUAUUCCUGAAACCGU  C     A--|         U   C   GC       ACUCAC 
                  UG UAUGU   UUUUCGGGUU CAU GUC  CCUCGAC      A
                  AC GUAUA   AAAAGCCCGA GUA CGG  GGAGUUG      G
GGGUAAAGUUCCCAGGCA  U     AAC^         U   -   AU       UGAAGC 
 120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 Cb Ea Ma Yo
Star sequence

Cbr-Mir-7594-P1a_5p*

MirBase accessionNone
Sequence
0- UCGGGUUUCAUCGUCGCCCUCGAC -24
Get sequence
Mature sequence

Cbr-Mir-7594-P1a_3p

MirBase accessionMIMAT0029600
Sequence
40- UGAGGUAGGCAUGUAGCCCGAAA -63
Get sequence