MirGeneDB

MirGeneDB ID

Aca-Mir-9574

Family name MIR-9574 (all species)
Seed UUCAUCU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-9574
Paralogues
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
2: 141270233-141270287 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCUUCCUCAUCCUUUGUUUCCCCAGCCUUCUUUCAUCUCUGAAAUGCAUAUGUUUUAGCACCAUUUGUAUUUCAGAGAUGGAGGGCCGAAGAAACGCAUACGCUUGAUAUUGAAU
Get precursor sequence
Structure
        10             20        30        40        50       
UCUUCCUCAUCCUUUGU-----|  CCCA      UUU               U   UUUU 
                      UUC    GCCUUC   CAUCUCUGAAAUGCA AUG    \
                      AAG    CGGGAG   GUAGAGACUUUAUGU UAC    A
UAAGUUAUAGUUCGCAUACGCA^  AAGC      ---               U   CACG 
   110       100        90           80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-9574_5p

MirBase accessionMIMAT0037582
Sequence
0- UUUCAUCUCUGAAAUGCAUAUG -22
Get sequence
Star sequence

Aca-Mir-9574_3p*

MirBase accessionMIMAT0037583
Sequence
33- UUUGUAUUUCAGAGAUGGAGGG -55
Get sequence