MirGeneDB

MirGeneDB ID

Aca-Mir-9572

Family name MIR-9572 (all species)
Seed ACAGCCU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-9572
Paralogues
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
GL343262.1: 1379996-1380056 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAAUCUCAACAAUAAAUGUCUCUGGGUUACUGUGGGUUUUCCAGUCUGUAUGGCCAUGUUCCAGAAGCAUACAGCCUGGAAAACUUGCAGCAACCCAGUGGUUCCGGCCACGAAAGCCUUU
Get precursor sequence
Structure
        10          20        30        40        50          
UAAUCUCAACAAUAAAUG--| U       A   UG          U       GCCAUGU 
                    UC CUGGGUU CUG  GGUUUUCCAG CUGUAUG       \
                    GG GACCCAA GAC  UCAAAAGGUC GACAUAC       U
UUUCCGAAAGCACCGGCCUU^ U       C   GU          C       GAAGACC 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-9572_5p*

MirBase accessionMIMAT0037576
Sequence
0- UGUGGGUUUUCCAGUCUGUAUG -22
Get sequence
Mature sequence

Aca-Mir-9572_3p

MirBase accessionMIMAT0037577
Sequence
39- UACAGCCUGGAAAACUUGCAGC -61
Get sequence