MirGeneDB

MirGeneDB ID

Aca-Mir-5435

Family name MIR-5435 (all species)
Seed AUGACCU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-5435b
Paralogues
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
2: 25825607-25825663 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUACAGCUGGAAGUUGCCAGAGUCAUUCUGGAUGACCUAGAAAAUUCCUAGAGAGGUAUCAUAUUUAGGAAUUUGCUAGUUCUUCCAGGAAGACUGCAUGGUAAUCUGCAGUGGAAG
Get precursor sequence
Structure
        10        20          30        40        50        
CUACAGCUGGAAGUUGCCAG--|   A       U  C    A           GAGGU 
                      AGUC UUCUGGA GA CUAG AAAUUCCUAGA     \
                      UCAG AGGACCU CU GAUC UUUAAGGAUUU     A
GAAGGUGACGUCUAAUGGUACG^   A       U  U    G           AUACU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-5435_5p

MirBase accessionMIMAT0022090
Sequence
0- GAUGACCUAGAAAAUUCCUAGA -22
Get sequence
Co-mature sequence

Aca-Mir-5435_3p

MirBase accessionMIMAT0022091
Sequence
35- UAGGAAUUUGCUAGUUCUUCCA -57
Get sequence