MirGeneDB

MirGeneDB ID

Aca-Mir-5426

Family name MIR-5426 (all species)
Seed ACUCUAA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-5426
Paralogues
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
3: 195203204-195203265 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCAUACUACACUAAUUCAGCAGUGCAGAUGCACUCUAAGUCUACUUCCACAGUCUUCACUUCAUGCAUCUGAGGAAGUAAACUUGGACUACAAAUGCAUACGCUACCAACUUCAUUCUCUUG
Get precursor sequence
Structure
        10         20         30        40        50        60
UCAUACUACACUAAUUC-   A-|    GA  CAC       C       A   UCUUCAC 
                  AGC  GUGCA  UG   UCUAAGU UACUUCC CAG       U
                  UCG  UACGU  AC   AGGUUCA AUGAAGG GUC       U
GUUCUCUUACUUCAACCA   CA^    AA  AUC       A       A   UACGUAC 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-5426_5p

MirBase accessionMIMAT0022046
Sequence
0- CACUCUAAGUCUACUUCCACAG -22
Get sequence
Co-mature sequence

Aca-Mir-5426_3p

MirBase accessionMIMAT0022047
Sequence
40- GAGGAAGUAAACUUGGACUACA -62
Get sequence