MirGeneDB

MirGeneDB ID

Aca-Mir-5412

Family name MIR-5412 (all species)
Seed AGGGUCC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-5412
Paralogues
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
GL343214.1: 285133-285189 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UAAUCAGUGGAGAAAGGAGGAGUGGCAGAGAAGGGUCCAGGUUUUUUUCUUGUGAAUUUAAUUAAAGGAAAAUUUCUGGGUGCUUUUCUGCUGUACCCAUCUACACACAGAGAAAUG
Get precursor sequence
Structure
        10          20        30        40        50        
UAAUCAGUGGAGAAAGGA--| A UG         G       UU        GUGAAU 
                    GG G  GCAGAGAAG GUCCAGG  UUUUUCUU      \
                    CC U  CGUCUUUUC UGGGUCU  AAAAGGAA      U
GUAAAGAGACACACAUCUAC^ A GU         G       UU        AUUAAU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-5412_5p

MirBase accessionMIMAT0022030
Sequence
0- AAGGGUCCAGGUUUUUUUCUU -21
Get sequence
Star sequence

Aca-Mir-5412_3p*

MirBase accessionMIMAT0022031
Sequence
36- GGAAAAUUUCUGGGUGCUUUU -57
Get sequence