MirGeneDB

MirGeneDB ID

Aca-Mir-5405

Family name MIR-5405 (all species)
Seed GUUUUAU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-5405
Paralogues
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
GL343207.1: 3269097-3269153 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGGAGUUUACAAAUGCAAGUGGACAAUAUUGUUUUAUUUGCCUUCCUGUUUAGAAAUCAGCAGAACAGGGAGACAUCUAGGACAAGGAUGCCAGGCUUAAAUCUACAGUAUUUUCC
Get precursor sequence
Structure
        10         20          30        40        50        
UUGGAGUUUACAAAUGC-    --| A  AUA        UU  C          AGAAA 
                  AAGU  GG CA   UUGUUUUA  UG CUUCCUGUUU     \
                  UUCG  CC GU   AACAGGAU  AC GAGGGACAAG     U
CCUUUUAUGACAUCUAAA    GA^ -  AGG        CU  A          ACGAC 
     110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-5405_5p

MirBase accessionMIMAT0022018
Sequence
0- UGUUUUAUUUGCCUUCCUGUUU -22
Get sequence
Star sequence

Aca-Mir-5405_3p*

MirBase accessionMIMAT0022019
Sequence
35- ACAGGGAGACAUCUAGGACAAG -57
Get sequence