MirGeneDB

MirGeneDB ID

Aca-Mir-5399

Family name MIR-5399 (all species)
Seed UGCAAGA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-5399
Paralogues
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
3: 25386690-25386749 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UACAGGUGAAAAUCAUUGUUGGCCAGAAGACCAGAUUAUUUGUUGCUGUGCAAUUGUUUUGUAUAAAAUUGCAAGAGAAAUAGUCUGACAUUCUGACUUAUAAAAUAACAGCUGGAGUAU
Get precursor sequence
Structure
        10          20        30        40        50        60 
UACAGGUGAAAAUCAUU--| U  C     GAC          G  GCUG       GUUUU 
                   GU GG CAGAA   CAGAUUAUUU UU    UGCAAUU     \
                   UA UC GUCUU   GUCUGAUAAA AG    ACGUUAA     G
UAUGAGGUCGACAAUAAAA^ U  A     ACA          G  A---       AAUAU 
.       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-5399_5p*

MirBase accessionMIMAT0022008
Sequence
0- CCAGAUUAUUUGUUGCUGUGCAAUU -25
Get sequence
Mature sequence

Aca-Mir-5399_3p

MirBase accessionMIMAT0022009
Sequence
38- UUGCAAGAGAAAUAGUCUGACA -60
Get sequence