MirGeneDB

Gene name

Tca-Mir-282

Family name MIR-282 (all species)
MiRBase ID tca-mir-282
Paralogues
Orthologues Dme-Mir-282  Dpu-Mir-282 
Node of Origin (gene) Mandibulata
Node of Origin (family) Mandibulata
Genome context
(Tcas5.2)
LG7: 12681808-12681866 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CCCGAUCCAGGACCCACUGAGGUGUAGAGGUAGCCUCUCCUAGGCUUUGUCUGUGAAUUUGGCCGAGACAUAGCCUGAUUGAGGCUAACUUUAGCCUUAGCACCACACUCAUCUCGUUU
Get precursor sequence
Structure
        10           20        30        40        50         
CCCGAUCCAGGACCCAC---|     G     G       UCC      U     GUGAAU 
                    UGAGGU UAGAG UAGCCUC   UAGGCU UGUCU      \
                    AUUCCG AUUUC AUCGGAG   GUCCGA ACAGA      U
UUUGCUCUACUCACACCACG^     -     A       UUA      U     GCCGGU 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Mature sequence

Tca-Mir-282_5p

MirBase accessionMIMAT0008386
Sequence
0- UAGCCUCUCCUAGGCUUUGUCU -22
Get sequence
Seed sequenceAGCCUCU
Star sequence

Tca-Mir-282_3p*

MirBase accessionMIMAT0019126
Sequence
37- ACAUAGCCUGAUUGAGGCUAAC -59
Get sequence