MirGeneDB

Gene name

Dpu-Mir-282

Family name MIR-282 (all species)
MiRBase ID
Paralogues
Orthologues Aae-Mir-282-P1  Aae-Mir-282-P2  Bge-Mir-282  Dan-Mir-282  Dme-Mir-282  Dmo-Mir-282  Hme-Mir-282  Tca-Mir-282 
Node of Origin (gene) Mandibulata
Node of Origin (family) Mandibulata
Genome context
(Daphnia_pulex.V1.0)
DAPPUscaffold_57: 216593-216687 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAUUUGGAAUUCAAACAGAUACGUGCUGCGUAGCCUCUCCUAGGCUUUGUCUUGUGAACGACGGAAUUUUUAUAUUUUCGUCGGGAAAAACUGAAAUUCUAGACAACGUCUCGGAGAGCGCUUCGCAGAGAGUAUUGACUGUCAACAUUCCAGAA
Get precursor sequence
Structure
        10          20        30         40        50        60        70      
AAUUUGGAAUUCAAACA--     GUG     U   -|     U    U      UGUGAACGACGGAAUUUUUAUAU 
                   GAUAC   CUGCG AGC CUCUCC AGGC UUGUCU                       U
                   UUAUG   GACGC UCG GAGAGG UCUG AACAGA                       U
AAGACCUUACAACUGUCAG     AGA     U   C^     C    C      UCUUAAAGUCAAAAAGGGCUGCU 
   150       140       130       120       110       100        90        80
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Dpu-Mir-282_5p

MirBase accessionNone
Sequence
0- UAGCCUCUCCUAGGCUUUGUCU -22
Get sequence
Seed sequenceAGCCUCU
Star sequence

Dpu-Mir-282_3p*

MirBase accessionNone
Sequence
72- ACAACGUCUCGGAGAGCGCUUCG -95
Get sequence