MirGeneDB

MirGeneDB ID

Hme-Mir-282

Family name MIR-282 (all species)
Seed AGCCUCU
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID hme-mir-282
Paralogues
Orthologues Aae-Mir-282-P1  Aae-Mir-282-P2  Bge-Mir-282  Dan-Mir-282  Dme-Mir-282  Dmo-Mir-282  Dpu-Mir-282  Tca-Mir-282 
Node of Origin (locus) Pancrustacea
Node of Origin (family) Pancrustacea
Genome context
(Hmel_1)
HE670913: 81384-81446 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAGAAGAUAUGAAGAGCUGGGAUGUUGACCUAGCCUCUCCUUGGCUUUGUCUGUAUCUUACGAUGUUUCAGACAUAGCCUGAUAGAGGUUACGUUUUGUCCCGUUUACUUCUACAAUAGAAGA
Get precursor sequence
Structure
        10           20        30        40        50        60 
AAGAAGAUAUGAAGAGCU---|     UU   C        CCUU    U     GUAUCUUA 
                     GGGAUG  GAC UAGCCUCU    GGCU UGUCU        \
                     CCCUGU  UUG AUUGGAGA    CCGA ACAGA        C
AGAAGAUAACAUCUUCAUUUG^     U-   C        UAGU    U     CUUUGUAG 
 120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Mature sequence

Hme-Mir-282_5p

MirBase accessionMIMAT0024968
Sequence
0- UAGCCUCUCCUUGGCUUUGUCU -22
Get sequence
Star sequence

Hme-Mir-282_3p*

MirBase accessionNone
Sequence
41- ACAUAGCCUGAUAGAGGUUACG -63
Get sequence