MirGeneDB

Gene name

Dme-Mir-282

Family name MIR-282 (all species)
MiRBase ID dme-mir-282
Paralogues
Orthologues Aae-Mir-282-P1  Aae-Mir-282-P2  Bge-Mir-282  Dan-Mir-282  Dmo-Mir-282  Dpu-Mir-282  Hme-Mir-282  Tca-Mir-282 
Node of Origin (gene) Mandibulata
Node of Origin (family) Mandibulata
Genome context
(dm6)
chr3L: 3251038-3251102 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGUUCUUUAACUAUAGUUUCCUUCUAAAUCUAGCCUCUACUAGGCUUUGUCUGUGCAUUCGAAAGCCGAUCAGACAUAGCCUAUAAGAGGUUAGGUGUACCAAGGCGAACAAUCAGCGAAAACGG
Get precursor sequence
Structure
        10         20         30        40        50        60  
CGUUCUUUAACUAUAGUUU-    CUAA-|          AC      U     GUGCAUUCG 
                    CCUU     AUCUAGCCUCU  UAGGCU UGUCU         \
                    GGAA     UGGAUUGGAGA  AUCCGA ACAGA         A
GGCAAAAGCGACUAACAAGC    CCAUG^          AU      U     CUAGCCGAA 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Mature sequence

Dme-Mir-282_5p

MirBase accessionMIMAT0000346
Sequence
0- UAGCCUCUACUAGGCUUUGUCU -22
Get sequence
Seed sequenceAGCCUCU
Validated targets microrna.org: MIMAT0000346
TargetScanFly: dme-miR-282
Star sequence

Dme-Mir-282_3p*

MirBase accessionMIMAT0020809
Sequence
43- ACAUAGCCUAUAAGAGGUUAGG -65
Get sequence