MirGeneDB

Gene name

Pfl-Mir-4818-P2

Family name MIR-4818 (all species)
MiRBase ID
Paralogues Pfl-Mir-4818-P1  Pfl-Mir-4818-P4  Pfl-Mir-4818-P5  Pfl-Mir-4818-P6  Pfl-Mir-4818-P7 
Orthologues Sko-Mir-4818-P2 
Node of Origin (gene) Enteropneusta
Node of Origin (family) Hemichordata
Genome context
(Pfl)
LD345931.1: 65041-65101 [-]
Precursor
(pre-Mir +30nt flank)
AGAAUAGACUUCACACUGGUGUGUAUUGUUCUCUAUUAUUCAGUGCAAAAUGGAGUGAAUUGUCUAUUCCAUUGCACUGAAUAGUGGGGCACAGUGGACACUACAGUGAAUCAUGUAUUUC
Get precursor sequence
Structure
        10          20        30        40        50        60 
AGAAUAGACUUCACACU--|    G      U                 AA     GUGAAU 
                   GGUGU UAUUGU CUCUAUUAUUCAGUGCA  AUGGA      \
                   UCACA GUGACA GGGGUGAUAAGUCACGU  UACCU      U
CUUUAUGUACUAAGUGACA^    G      C                 --     UAUCUG 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-4818-P2_5p* (predicted)

MirBase accessionNone
Sequence
0- CUCUAUUAUUCAGUGCAAAAUGGA -24
Get sequence
Mature sequence

Pfl-Mir-4818-P2_3p

MirBase accessionNone
Sequence
39- CAUUGCACUGAAUAGUGGGGCA -61
Get sequence
Seed sequenceAUUGCAC