MirGeneDB

Gene name

Pfl-Mir-4818-P1

Family name MIR-4818 (all species)
MiRBase ID
Paralogues Pfl-Mir-4818-P2  Pfl-Mir-4818-P4  Pfl-Mir-4818-P5  Pfl-Mir-4818-P6  Pfl-Mir-4818-P7 
Orthologues Sko-Mir-4818-P1 
Node of Origin (gene) Enteropneusta
Node of Origin (family) Hemichordata
Genome context
(Pfl)
LD345931.1: 65685-65745 [-]
Precursor
(pre-Mir +30nt flank)
UUGUUUUUGAAGAAAGUGGUUUUAUAGGAAGCUUUACAAGGGAGAGUAGAUUAUGUUACCCUUAUGCUAAUUGCACUCCCUUGUGGGGCUUCCUAUCACCACCAGUACUUCGUAUGCCUUU
Get precursor sequence
Structure
        10            20        30        40        50        60
UUGUUUUUGAAGAAAGU----|  UUU                     A    A   UGUUAC 
                     GGU   AUAGGAAGCUUUACAAGGGAG GUAG UUA      C
                     CCA   UAUCCUUCGGGGUGUUCCCUC CGUU AAU      C
UUUCCGUAUGCUUCAUGACCA^  C--                     A    -   CGUAUU 
 .       110       100          90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-4818-P1_5p* (predicted)

MirBase accessionNone
Sequence
0- GCUUUACAAGGGAGAGUAGAUUA -23
Get sequence
Mature sequence

Pfl-Mir-4818-P1_3p

MirBase accessionNone
Sequence
39- AUUGCACUCCCUUGUGGGGCUU -61
Get sequence
Seed sequenceUUGCACU