MirGeneDB

Gene name

Pfl-Mir-4818-P5

Family name MIR-4818 (all species)
MiRBase ID
Paralogues Pfl-Mir-4818-P1  Pfl-Mir-4818-P2  Pfl-Mir-4818-P4  Pfl-Mir-4818-P6  Pfl-Mir-4818-P7 
Orthologues Sko-Mir-4818-P5 
Node of Origin (gene) Enteropneusta
Node of Origin (family) Hemichordata
Genome context
(Pfl)
LD345931.1: 60244-60301 [-]
Precursor
(pre-Mir +30nt flank)
GUCAUUGGCAACAAACUUGUGAAGAUAUAGCCUCAUUGCCGUGUGCAAUCAGUACAAAGUAAUUCUCAUUGCACACAGUAGUGGGGCUUUAUCUUACAAACUUUCCACAUACCAUGUA
Get precursor sequence
Structure
        10           20        30        40        50        
GUCAUUGGCAACAAACU---|    A    U           C         C  UACAA 
                    UGUGA GAUA AGCCUCAUUGC GUGUGCAAU AG     A
                    ACAUU CUAU UCGGGGUGAUG CACACGUUA UC     G
AUGUACCAUACACCUUUCAA^    -    U           A         C  UUAAU 
      110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-4818-P5_5p* (predicted)

MirBase accessionNone
Sequence
0- CCUCAUUGCCGUGUGCAAUCAG -22
Get sequence
Mature sequence

Pfl-Mir-4818-P5_3p

MirBase accessionNone
Sequence
36- CAUUGCACACAGUAGUGGGGCU -58
Get sequence
Seed sequenceAUUGCAC