MirGeneDB

Gene name

Pfl-Mir-153

Family name MIR-153 (all species)
MiRBase ID
Paralogues
Orthologues Aca-Mir-153-P1  Aca-Mir-153-P2  Ami-Mir-153-P1  Ami-Mir-153-P2  Bfl-Mir-153  Bta-Mir-153-P1  Bta-Mir-153-P2  Cfa-Mir-153-P1  Cfa-Mir-153-P2  Cgi-Mir-153  Cli-Mir-153-P1  Cli-Mir-153-P2  Cpi-Mir-153-P1  Cpi-Mir-153-P2  Cpo-Mir-153-P2  Cte-Mir-153  Dno-Mir-153-P1  Dno-Mir-153-P2  Dpu-Mir-153  Dre-Mir-153-P1a  Dre-Mir-153-P1b  Dre-Mir-153-P2  Efe-Mir-153-P3  Efe-Mir-153-P4  Ete-Mir-153-P2  Gga-Mir-153-P2  Hsa-Mir-153-P1  Hsa-Mir-153-P2  Isc-Mir-153  Lgi-Mir-153  Mdo-Mir-153-P1  Mdo-Mir-153-P2  Mml-Mir-153-P1  Mml-Mir-153-P2  Mmu-Mir-153-P2  Ocu-Mir-153-P2  Pmi-Mir-153  Rno-Mir-153-P2  Sha-Mir-153-P1  Sha-Mir-153-P2  Sko-Mir-153  Spu-Mir-153  Xtr-Mir-153-P1  Xtr-Mir-153-P2 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Pfl)
LD348957.1: 284194-284252 [+]
Precursor
(pre-Mir +30nt flank)
CUAGUACUACUAACUCUGCCACUGGCCCAGUCAUUUUUGUGCAUAUGCAAGCUGUCAAGUAUACCACUUGCAUAGUCACAAAAGUGAUUGGGACAACUGAGUGCGCACUAACAACCAAG
Get precursor sequence
Structure
        10        20          30        40        50         
CUAGUACUACUAACUCUGCCAC--| G                CA        CUGUCAA 
                        UG CCCAGUCAUUUUUGUG  UAUGCAAG       \
                        AC GGGUUAGUGAAAACAC  AUACGUUC       G
GAACCAACAAUCACGCGUGAGUCA^ A                UG        ACCAUAU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-153_5p*

MirBase accessionNone
Sequence
0- UCAUUUUUGUGCAUAUGCAAGC -22
Get sequence
Mature sequence

Pfl-Mir-153_3p

MirBase accessionNone
Sequence
37- UUGCAUAGUCACAAAAGUGAUU -59
Get sequence
Seed sequenceUGCAUAG