MirGeneDB

Gene name

Cbr-Mir-73-P2b

Family name MIR-73 (all species)
MiRBase ID cbr-mir-74b
Paralogues Cbr-Mir-73-P1a  Cbr-Mir-73-P1b  Cbr-Mir-73-P2a  Cbr-Mir-73-P3a  Cbr-Mir-73-P3b 
Orthologues Cel-Mir-73-P2 
Node of Origin (gene) C. briggsae
Node of Origin (family) Caenorhabditis
Genome context
(CB4)
X: 4426739-4426799 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-73-P2b)
Mir-9-o10 X: 4419753-4419815 [-] UCSC Ensembl
Mir-785-P2 X: 4421255-4421318 [+] UCSC Ensembl
Mir-73-P2a X: 4426608-4426674 [-] UCSC Ensembl
Mir-73-P1a X: 4426903-4426964 [-] UCSC Ensembl
Mir-2231 X: 4430575-4430638 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGCUACUAUUCAAGCCCCUGCCACACUUUUGGACUUCCUUCUCGUUCCCAGCAAAAUGCACAGUUUGCUGGCAAGACUAGGCAGUCCAGAUGUGUGGCAGCGGCAGUUUUUGGUGAGUUU
Get precursor sequence
Structure
        10          20        30        40        50        60
CUGCUACUAUUCAAGCC- -|        U        U   UC  GUUC     AAAAUG 
                  C CUGCCACAC UUUGGACU CCU  UC    CCAGC      C
                  G GACGGUGUG AGACCUGA GGA  AG    GGUCG      A
UUUGAGUGGUUUUUGACG C^        U        C   UC  AAC-     UUUGAC 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
20 Cb Ea Yo
Mature sequence

Cbr-Mir-73-P2b_5p

MirBase accessionMIMAT0011501
Sequence
0- UGGACUUCCUUCUCGUUCCCAGC -23
Get sequence
Seed sequenceGGACUUC
Co-mature sequence

Cbr-Mir-73-P2b_3p

MirBase accessionMIMAT0011502
Sequence
39- UGGCAAGACUAGGCAGUCCAGA -61
Get sequence
Seed sequenceGGCAAGA