MirGeneDB

Gene name

Cbr-Mir-73-P2a

Family name MIR-73 (all species)
MiRBase ID cbr-mir-74a
Paralogues Cbr-Mir-73-P1a  Cbr-Mir-73-P1b  Cbr-Mir-73-P2b  Cbr-Mir-73-P3a  Cbr-Mir-73-P3b 
Orthologues Cel-Mir-73-P2 
Node of Origin (gene) C. briggsae
Node of Origin (family) Caenorhabditis
Genome context
(CB4)
X: 4426608-4426674 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-73-P2a)
Mir-9-o10 X: 4419753-4419815 [-] UCSC Ensembl
Mir-785-P2 X: 4421255-4421318 [+] UCSC Ensembl
Mir-73-P2b X: 4426739-4426799 [-] UCSC Ensembl
Mir-73-P1a X: 4426903-4426964 [-] UCSC Ensembl
Mir-2231 X: 4430575-4430638 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCGAGACUAAGAAAAAAGGUCCGCACUUUUGGGCUUCCAUAUCUUUCCCAGCUCCUCUCAUUUACUAUGGAUGCUGGCAAGAAAUGGCAGUCUAGAUGUGCAAAAUCCUGCAACUCUCUCUCUCGU
Get precursor sequence
Structure
        10        20          30        40        50        60   
ACCGAGACUAAGAAAAAA  UCC--|   U        U    A    UC     UCCUCUCAU 
                  GG     GCAC UUUGGGCU CCAU UCUU  CCAGC         U
                  CC     CGUG AGAUCUGA GGUA AGAA  GGUCG         U
UGCUCUCUCUCUCAACGU  UAAAA^   U        C    A    C-     UAGGUAUCA 
     120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
20 Cb Ea Yo
Star sequence

Cbr-Mir-73-P2a_5p*

MirBase accessionNone
Sequence
0- UGGGCUUCCAUAUCUUUCCCAGC -23
Get sequence
Mature sequence

Cbr-Mir-73-P2a_3p

MirBase accessionMIMAT0000483
Sequence
45- UGGCAAGAAAUGGCAGUCUAGA -67
Get sequence
Seed sequenceGGCAAGA