MirGeneDB

MirGeneDB ID

Sto-Novel-1

Family name STO-NOVEL-1 (all species)
Seed UUCUAAU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) S. torazame
Node of Origin (family) S. torazame
Genome context
(miRNA_loci_genome)
BFAA01001588.1: 508224-508278 [+]
Precursor
(pre-Mir +30nt flank)
UUCUGGCUUCUCAAACAAUGUCAUAGCACCAGUGUGAUAACACUUAGAAGGGAACUAUUUAUCAUUCUAAUUGUCAUCACUCAGGUGUUGCGUCUGACUACACAACCAUUCAGCU
Get precursor sequence
Structure
        10        20          30        40        50       
UUCUGGCUUCUCAAACAAUGUCA--|      AGU     A   C      G  AACU 
                         UAGCACC   GUGAU ACA UUAGAA GG    \
                         GUUGUGG   CACUA UGU AAUCUU CU    A
UCGACUUACCAACACAUCAGUCUGC^      ACU     C   U      A  AUUU 
   110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Novel-1_5p*

MirBase accessionNone
Sequence
0- AGUGUGAUAACACUUAGAAGGG -22
Get sequence
Mature sequence

Sto-Novel-1_3p

MirBase accessionNone
Sequence
33- AUUCUAAUUGUCAUCACUCAGG -55
Get sequence