MirGeneDB

MirGeneDB ID

Spu-Mir-4847

Family name MIR-4847 (all species)
Seed AAUGAUG
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-4847
Paralogues
Orthologues
Node of Origin (locus) S. purpuratus
Node of Origin (family) S. purpuratus
Genome context
(Spur_3.1)
Scaffold387: 398514-398577 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GGAGGAGAUGGCGCACAUACUUUCACCUCAUAAUGAUGGCGCGGUGCGGUGCGAUGUGAUAUCAAAAAAUUCGCUCUCAUUCGCCAUCAUUCUUAGGUGUAGUUAGCUCAGCCAUGCAAUUCAC
Get precursor sequence
Structure
        10           20        30        40        50        60  
GGAGGAGAUGGCGCACAU---|  UU     CAU          C    C  U    UGUGAUA 
                     ACU  CACCU   AAUGAUGGCG GGUG GG GCGA       U
                     UGA  GUGGA   UUACUACCGC UUAC UC CGCU       C
CACUUAACGUACCGACUCGAU^  U-     UUC          -    -  U    UAAAAAA 
  120       110       100         90         80         70
Deep sequencing
Go to detailed chart
CommentAlthough there is no star recorded for Mir-4847 expression of the 5p arm is deeply conserved across echinoid echinoderms.
3' NTU Unknown
MotifsUGUG in loop
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Mature sequence

Spu-Mir-4847_5p

MirBase accessionMIMAT0020069
Sequence
0- UAAUGAUGGCGCGGUGCGGUGCGA -24
Get sequence
Star sequence

Spu-Mir-4847_3p* (predicted)

MirBase accessionNone
Sequence
42- GCUCUCAUUCGCCAUCAUUCUU -64
Get sequence