MirGeneDB

MirGeneDB ID

Spu-Mir-2010

Family name MIR-2010 (all species)
Seed UACUGUU
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-2010
Paralogues
Orthologues Pmi-Mir-2010 
Node of Origin (locus) Eleutherozoa
Node of Origin (family) Eleutherozoa
Genome context
(Spur_3.1)
Scaffold191: 189313-189377 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GUCUUCCAUGCUCUCAUGGUACGCCAGCAAGGGCUGGUUUCUCCAGUAAUUUGUAUCUUCAUUAUAGCAUCAAUUACUGUUGAUGUCAGCCCCUUGCUGGUAUACUGCCCUCUACAAUCCUGAUG
Get precursor sequence
Structure
        10          20        30         40        50        60 
GUCUUCCAUGCUCUCAU--    CG       -|      UU  UC        UGUAUCUUC 
                   GGUA  CCAGCAA GGGCUGG  UC  CAGUAAUU         A
                   UCAU  GGUCGUU CCCGACU  AG  GUCAUUAA         U
GUAGUCCUAACAUCUCCCG    AU       C^      GU  UU        CUACGAUAU 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-2010_5p* (predicted)

MirBase accessionNone
Sequence
0- GGGCUGGUUUCUCCAGUAAUU -21
Get sequence
Mature sequence

Spu-Mir-2010_3p

MirBase accessionMIMAT0009751
Sequence
43- UUACUGUUGAUGUCAGCCCCUU -65
Get sequence