MirGeneDB

MirGeneDB ID

Spu-Mir-2006

Family name MIR-2006 (all species)
Seed AGCACAC
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-2006
Paralogues
Orthologues Pfl-Mir-2006  Pmi-Mir-2006  Sko-Mir-2006 
Node of Origin (locus) Ambulacraria
Node of Origin (family) Ambulacraria
Genome context
(Spur_3.1)
Scaffold2497: 40793-40861 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AUACUUCAUCCUCAAGGCCGUAGCAUGUGCCAUCGCCACCAAGUGUACUUCAGUGGACAUAUGUCGUUUUUAAAUCUGAGCACACUUGGUAGCGGUGCCGUGAGCUACUCCCAUACAUCGGACCAUGCA
Get precursor sequence
Structure
        10          20        30        40        50        60    
AUACUUCAUCCUCAAGGCC--|    A GU C      C         A  U   UGGACAUAUG 
                     GUAGC U  G CAUCGC ACCAAGUGU CU CAG          U
                     CAUCG G  C GUGGCG UGGUUCACA GA GUC          C
ACGUACCAGGCUACAUACCCU^    A UG C      A         C  -   UAAAUUUUUG 
       120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-2006_5p*

MirBase accessionNone
Sequence
0- CAUCGCCACCAAGUGUACUUCAG -23
Get sequence
Mature sequence

Spu-Mir-2006_3p

MirBase accessionMIMAT0009747
Sequence
47- GAGCACACUUGGUAGCGGUGCC -69
Get sequence