MirGeneDB

MirGeneDB ID

Dan-Novel-16

Family name DAN-NOVEL-16 (all species)
Seed GUCAGGG
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) D. ananassae
Node of Origin (family) D. ananassae
Genome context
(Dana_caf1)
scaffold_13322: 1691-1751 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUCACUCGAGGAACUAACAAAUUCAAUUUCAUGCCCGCUUGCCCUCGUGACUUUGGAAAAUGGCGGAAAAGUCAGGGGGGAAGUGGGCUGAAAUCGGAGCAAAAUCAAGCCAGUUCCGGUC
Get precursor sequence
Structure
        10        20          30        40        50        60 
UUCACUCGAGGAACUAACAAA--|  A      U        G     G       GGAAAA 
                       UUC AUUUCA GCCCGCUU CCCUC UGACUUU      \
                       AGG UAAAGU CGGGUGAA GGGGG ACUGAAA      U
CUGGCCUUGACCGAACUAAAACG^  C      -        -     G       AGGCGG 
 .       110       100        90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Star sequence

Dan-Novel-16_5p*

MirBase accessionNone
Sequence
0- AUGCCCGCUUGCCCUCGUGACUUU -24
Get sequence
Mature sequence

Dan-Novel-16_3p

MirBase accessionNone
Sequence
39- AGUCAGGGGGGAAGUGGGCUGA -61
Get sequence