MirGeneDB

MirGeneDB ID

Dan-Novel-11

Family name DAN-NOVEL-11 (all species)
Seed AAGCAGU
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) D. ananassae
Node of Origin (family) D. ananassae
Genome context
(Dana_caf1)
scaffold_12929: 3159781-3159857 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUUCGGUUUUUUUUUUUCUUUUGGAAUUCAGAUAUUUUUCCAUUCGUUUUGGUGGGUGACAGCUGUUUGUUGGUUUGAAGAACGCCAAAGCAGUGGGAAAAUCUCUGAAUAUUGAAAGCGACAAGCGGCAAGCUCCC
Get precursor sequence
Structure
        10          20        30        40        50        60        
UUUCGGUUUUUUUUUUU--|   UG A       U           C       UGGGUGACAGCUGUU 
                   CUUU  G AUUCAGA AUUUUUCCAUU GUUUUGG               U
                   GAAA  U UAAGUCU UAAAAGGGUGA CGAAACC               G
CCCUCGAACGGCGAACAGC^   GU A       C           -       GCAAGAAGUUUGGUU 
     130       120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Star sequence

Dan-Novel-11_5p*

MirBase accessionNone
Sequence
0- GAUAUUUUUCCAUUCGUUUUGG -22
Get sequence
Mature sequence

Dan-Novel-11_3p

MirBase accessionNone
Sequence
56- AAAGCAGUGGGAAAAUCUCUG -77
Get sequence