MirGeneDB

MirGeneDB ID

Dan-Mir-284

Family name MIR-284 (all species)
Seed UCAGCAA
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-284
Paralogues
Orthologues Dme-Mir-284  Dmo-Mir-284 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dana_caf1)
scaffold_12911: 3308013-3308092 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CUACCAACAAAAGGCAAUUGCGUUGCAGUUCCUGGAAUUAAGUUGACUGUGUAGCCUGUGAGGGCAAGGCUUGAGAACUGCUUCAGAAGUCAGCAACUUGAUUCCAGCAAUUGCGGCCCAAGUACAGCAGAAAGAGCCGU
Get precursor sequence
Structure
        10          20        30        40        50        60          
CUACCAACAAAAGGCAA--|  C         C              A   UGUAGCCUGUGAGGGCAAGG 
                   UUG GUUGCAGUU CUGGAAUUAAGUUG CUG                    \
                   AAC CGGCGUUAA GACCUUAGUUCAAC GAC                    C
UGCCGAGAAAGACGACAUG^  C         C              -   UGAAGACUUCGUCAAGAGUU 
.       130       120       110       100         90        80
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Star sequence

Dan-Mir-284_5p*

MirBase accessionNone
Sequence
0- CCUGGAAUUAAGUUGACUGUGUAGC -25
Get sequence
Mature sequence

Dan-Mir-284_3p

MirBase accessionMIMAT0008415
Sequence
58- GUCAGCAACUUGAUUCCAGCAA -80
Get sequence