MirGeneDB

MirGeneDB ID

Dan-Mir-14

Family name MIR-14 (all species)
Seed CAGUCUU
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-14
Paralogues
Orthologues Aae-Mir-14  Bge-Mir-14  Dme-Mir-14  Dmo-Mir-14  Hme-Mir-14  Tca-Mir-14 
Node of Origin (locus) Pterygota
Node of Origin (family) Pterygota
Genome context
(Dana_caf1)
scaffold_13266: 183971-184029 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UAGUUUUCAUUAACGUACUGCAACCUAUGUGGGAGCGAGACGGGGACUCACUGUGCUUAUUAAAUAGUCAGUCUUUUUCUCUCUCCUAUACAAAUUGCGGGCGUAUCAACAUGUCGACA
Get precursor sequence
Structure
        10          20        30        40        50         
UAGUUUUCAUUAACGUA--|     CCUA        C    CG      C   GUGCUU 
                   CUGCAA    UGUGGGAG GAGA  GGGACU ACU      \
                   GGCGUU    AUAUCCUC CUCU  UUCUGA UGA      A
ACAGCUGUACAACUAUGCG^     AAAC        U    UU      C   UAAAUU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Da
Star sequence

Dan-Mir-14_5p*

MirBase accessionNone
Sequence
0- GGGAGCGAGACGGGGACUCACU -22
Get sequence
Mature sequence

Dan-Mir-14_3p

MirBase accessionMIMAT0008460
Sequence
37- UCAGUCUUUUUCUCUCUCCUAU -59
Get sequence