MirGeneDB

MirGeneDB ID

Cbr-Mir-73-P1b

Family name MIR-73 (all species)
Seed GGCAAGA
Species Roundworm (Caenorhabditis briggsae)
MiRBase ID cbr-mir-73b
Paralogues Cbr-Mir-73-P1a  Cbr-Mir-73-P2a  Cbr-Mir-73-P2b  Cbr-Mir-73-P3a  Cbr-Mir-73-P3b 
Orthologues Cel-Mir-73-P1 
Node of Origin (locus) C. briggsae
Node of Origin (family) Caenorhabditis
Genome context
(CB4)
I: 6796238-6796300 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUCGCCUAAAAAACGUCCCAAAAUUCCGAUCCGGCUUCCACAUCGAGCCUCAGCUAGAUCCAUAACUUGCUGGCAAGAUGUUGGCAGUCGCAUUGGAUAAAGGAGACACUUGAAAUAUUAGUU
Get precursor sequence
Structure
        10           20        30        40         50        60 
UUCGCCUAAAAAACGUC---| AAAAU      C     U   -    GA   UC   UAGAUC 
                    CC     UCCGAU CGGCU CCA CAUC  GCC  AGC      C
                    GG     AGGUUA GCUGA GGU GUAG  CGG  UCG      A
UUGAUUAUAAAGUUCACAGA^ AAAU-      C     C   U    AA   --   UUCAAU 
 120       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 Cb Ea Ma Yo
Star sequence

Cbr-Mir-73-P1b_5p*

MirBase accessionNone
Sequence
0- CCGGCUUCCACAUCGAGCCUCAGC -24
Get sequence
Mature sequence

Cbr-Mir-73-P1b_3p

MirBase accessionMIMAT0011464
Sequence
40- UGGCAAGAUGUUGGCAGUCGCAU -63
Get sequence