MirGeneDB

Gene name

Tca-Mir-3843

Family name MIR-3843 (all species)
MiRBase ID tca-mir-3843
Paralogues
Orthologues
Node of Origin (gene) T. castaneum
Node of Origin (family) T. castaneum
Genome context
(Tcas5.2)
LG3: 15690171-15690228 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-3843)
Mir-3841 LG3: 15689576-15689634 [+] Ensembl
Mir-3840 LG3: 15689698-15689754 [+] Ensembl
Mir-9-o5 LG3: 15689817-15689876 [+] Ensembl
Mir-2-o56a LG3: 15689938-15689994 [+] Ensembl
Mir-279-o23 LG3: 15690069-15690126 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUCCGCGGGACUUGUGGCUGACAAGUUUUCAGUUGUUGAUGUGGCUUUAGUGGAGAUUUUACUGAAUUAAAGCUAUGUCAGCAAUUAAAAAAAUGUCGGGUCUUCAUCGGUUCAAUUU
Get precursor sequence
Structure
        10          20        30        40        50        
AUCCGCGGGACUUGUGG--|     AG    C                     GGAGAU 
                   CUGACA  UUUU AGUUGUUGAUGUGGCUUUAGU      U
                   GGCUGU  AAAA UUAACGACUGUAUCGAAAUUA      U
UUUAACUUGGCUACUUCUG^     AA    A                     AGUCAU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Mature sequence

Tca-Mir-3843_5p

MirBase accessionMIMAT0018732
Sequence
0- AGUUGUUGAUGUGGCUUUAGUG -22
Get sequence
Seed sequenceGUUGUUG
Star sequence

Tca-Mir-3843_3p*

MirBase accessionMIMAT0018733
Sequence
36- UUAAAGCUAUGUCAGCAAUUAA -58
Get sequence