MirGeneDB

Gene name

Tca-Mir-3840

Family name MIR-3840 (all species)
MiRBase ID tca-mir-3840
Paralogues
Orthologues
Node of Origin (gene) T. castaneum
Node of Origin (family) T. castaneum
Genome context
(Tcas5.2)
LG3: 15689698-15689754 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-3840)
Mir-3841 LG3: 15689576-15689634 [+] Ensembl
Mir-9-o5 LG3: 15689817-15689876 [+] Ensembl
Mir-2-o56a LG3: 15689938-15689994 [+] Ensembl
Mir-279-o23 LG3: 15690069-15690126 [+] Ensembl
Mir-3843 LG3: 15690171-15690228 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CUAUUAUUUUCACAUCAGUGAAUGCUUUGUAGGGGGUACUGUAAGUACGUACGAUUUUUUUAACGUAGUACGAACGGUACUCACUAUGAACGUUACACAGUUUUCAAUGCCAUAACU
Get precursor sequence
Structure
        10          20         30        40        50        
CUAUUAUUUUCACAUCA--   -|   C  UG   G         AA    G    AUUU 
                   GUG AAUG UU  UAG GGGUACUGU  GUAC UACG    U
                   CAC UUGC AA  AUC CUCAUGGCA  CAUG AUGC    U
UCAAUACCGUAACUUUUGA   A^   -  GU   A         AG    -    AAUU 
     110       100         90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Star sequence

Tca-Mir-3840_5p*

MirBase accessionMIMAT0018724
Sequence
0- AGGGGGUACUGUAAGUACGUACG -23
Get sequence
Mature sequence

Tca-Mir-3840_3p

MirBase accessionMIMAT0018725
Sequence
35- UAGUACGAACGGUACUCACUAU -57
Get sequence
Seed sequenceAGUACGA