MirGeneDB

Gene name

Dno-Mir-192-P2

Family name MIR-192 (all species)
MiRBase ID dno-mir-215
Paralogues Dno-Mir-192-P1 
Orthologues Aca-Mir-192-P2  Ami-Mir-192-P2  Bta-Mir-192-P2  Cfa-Mir-192-P2  Cli-Mir-192-P2  Cpi-Mir-192-P2  Cpo-Mir-192-P2  Ete-Mir-192-P2  Gga-Mir-192-P2  Hsa-Mir-192-P2  Mdo-Mir-192-P2  Mml-Mir-192-P2  Mmu-Mir-192-P2  Ocu-Mir-192-P2  Rno-Mir-192-P2  Xtr-Mir-192-P2 
Node of Origin (gene) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH579496: 2455274-2455333 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGCCAUCAUUAAGAAAUGGUGUACAGGAAAAUGACCUAUGAAUUGACAGACAAUAUAACUAAGUUUGUCUGUCAUUUCUGUAGGCCAAUUUUCUGUAUGUCUCUGCUCCUUCAAAAUCAG
Get precursor sequence
Structure
        10          20        30         40        50         
AGCCAUCAUUAAGAAAU-- GU          A  A     -|  U         AUAUAA 
                   G  GUACAGGAAA UG CCUAU GAA UGACAGACA      \
                   C  UAUGUCUUUU AC GGAUG CUU ACUGUCUGU      C
GACUAAAACUUCCUCGUCU UG          A  C     U^  U         UUGAAU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Mir-192-P2_5p

MirBase accessionMIMAT0047760
Sequence
0- AUGACCUAUGAAUUGACAGACA -22
Get sequence
Seed sequenceUGACCUA
Star sequence

Dno-Mir-192-P2_3p*

MirBase accessionMIMAT0047761
Sequence
37- UCUGUCAUUUCUGUAGGCCAAUU -60
Get sequence