MirGeneDB

MirGeneDB ID

Asu-Mir-36-o27

Family name MIR-36 (all species)
Seed CACCGGG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-36a
Paralogues Asu-Mir-36-o28  Asu-Mir-36-o29-v1  Asu-Mir-36-o29-v2  Asu-Mir-36-o30  Asu-Mir-36-o31  Asu-Mir-36-o32 
Orthologues Bge-Mir-36  Cgi-Mir-36  Cte-Mir-36  Dpu-Mir-36  Tca-Mir-36 
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold561: 396486-396545 [-]
Precursor
(pre-Mir +30nt flank)
AGCCAGUUGUUUCGCCUGAGUACGGUGUGUAGUGGAUGUACCCUCGGUUCGAUGUUUCUUUACUAUCAUCACCGGGUAUACAUUCAUCAAAUACCGUAGCUCAGUACAGUAGGCAGAACC
Get precursor sequence
Structure
        10         20         30        40        50        60
AGCCAGUUGUUUCGCCU-   -|       GUA         CC      UC    UUUCU 
                  GAG UACGGUGU   GUGGAUGUA  CUCGGU  GAUG     U
                  CUC AUGCCAUA   UACUUACAU  GGGCCA  CUAC     U
CCAAGACGGAUGACAUGA   G^       AAC         AU      --    UAUCA 
.       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-36-o27_5p*

MirBase accessionMIMAT0021439
Sequence
0- AGUGGAUGUACCCUCGGUUCGAUG -24
Get sequence
Mature sequence

Asu-Mir-36-o27_3p

MirBase accessionMIMAT0021440
Sequence
38- UCACCGGGUAUACAUUCAUCAA -60
Get sequence