MirGeneDB

MirGeneDB ID

Asu-Mir-36-o29-v1

Family name MIR-36 (all species)
Seed CACCGGG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-36c
Paralogues Asu-Mir-36-o27  Asu-Mir-36-o28  Asu-Mir-36-o29-v2  Asu-Mir-36-o30  Asu-Mir-36-o31  Asu-Mir-36-o32 
Orthologues Bge-Mir-36  Cgi-Mir-36  Cte-Mir-36  Dpu-Mir-36  Tca-Mir-36 
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
trace_ANBK02000028: 101-160 [+]
Clustered MiRNAs
(< 10kb from Mir-36-o29-v1)
Mir-36-o29-v1 trace_ANBK02000028: 101-160 [+]
Mir-36-o29-v2 trace_ANBK02000028: 101-160 [+]
Precursor
(pre-Mir +30nt flank)
GUUACCUGAAAUGGCAGCGAUGUGACGUGACGGGGAUUCUACUUUUGGUGAAGCGAGCUCAGAUGACUUCACCGGGCUCGAAUCCCUGUCCUGUCAUGAUUCAUGUGCUCAGUUCCACCU
Get precursor sequence
Structure
        10        20          30        40        50          
GUUACCUGAAAUGGCAGCGAU--|     U           UACU          CGAGCU 
                       GUGACG GACGGGGAUUC    UUUGGUGAAG      \
                       UACUGU CUGUCCCUAAG    GGGCCACUUC      C
UCCACCUUGACUCGUGUACUUAG^     C           CUC-          AGUAGA 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-36-o29-v1_5p*

MirBase accessionMIMAT0021443
Sequence
0- CGGGGAUUCUACUUUUGGUGAAG -23
Get sequence
Mature sequence

Asu-Mir-36-o29-v1_3p

MirBase accessionMIMAT0021444
Sequence
38- UCACCGGGCUCGAAUCCCUGUC -60
Get sequence