MirGeneDB

MirGeneDB ID

Asu-Mir-36-o31

Family name MIR-36 (all species)
Seed CACCGGG
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-36f
Paralogues Asu-Mir-36-o27  Asu-Mir-36-o28  Asu-Mir-36-o29-v1  Asu-Mir-36-o29-v2  Asu-Mir-36-o30  Asu-Mir-36-o32 
Orthologues Bge-Mir-36  Cgi-Mir-36  Cte-Mir-36  Dpu-Mir-36  Tca-Mir-36 
Node of Origin (locus) A. suum
Node of Origin (family) Protostomia
Genome context
(ASU_PRJNA80881_plustraces)
trace_ANBK02000051: 101-169 [+]
Precursor
(pre-Mir +30nt flank)
AACGGCGUCCUGGAAGCCGGCUGGAGCGUGACAUGGAUUCAGCUAUCUGUGGAGUAGUGCCUUCAAAACAAAUUCUUCACCGGGCUGCAAUCCUUGUCACGCCGGUCUUCUUAUCUCGCGUACUAUCCC
Get precursor sequence
Structure
        10            20        30         40        50        60    
AACGGCGUCCUGGAAGCC----|    GA        U     -     AUCU      UAGUGCCUU 
                      GGCUG  GCGUGACA GGAUU CAGCU    GUGGAG         C
                      CUGGC  CGCACUGU CCUAA GUCGG    CACUUC         A
CCCUAUCAUGCGCUCUAUUCUU^    --        U     C     GC--      UUAAACAAA 
       120       110         100        90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-36-o31_5p*

MirBase accessionMIMAT0021546
Sequence
0- ACAUGGAUUCAGCUAUCUGUGGAG -24
Get sequence
Mature sequence

Asu-Mir-36-o31_3p

MirBase accessionMIMAT0021547
Sequence
46- UCACCGGGCUGCAAUCCUUGUCA -69
Get sequence