MirGeneDB

MirGeneDB ID

Asu-Mir-137

Family name MIR-137 (all species)
Seed UAUUGCU
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-234
Paralogues
Orthologues Aae-Mir-137-P11  Aae-Mir-137-P12  Aca-Mir-137-P1-v1  Aca-Mir-137-P1-v2  Aca-Mir-137-P2  Ami-Mir-137-P1-v1  Ami-Mir-137-P1-v2  Ami-Mir-137-P2  Bfl-Mir-137  Bge-Mir-137-P13-v1  Bge-Mir-137-P13-v2  Bge-Mir-137-P14-v1  Bge-Mir-137-P14-v2  Bta-Mir-137-P1-v1  Bta-Mir-137-P1-v2  Cbr-Mir-137  Cel-Mir-137  Cfa-Mir-137-P1-v1  Cfa-Mir-137-P1-v2  Cgi-Mir-137  Cli-Mir-137-P1-v1  Cli-Mir-137-P1-v2  Cli-Mir-137-P2  Cpi-Mir-137-P1-v1  Cpi-Mir-137-P1-v2  Cpi-Mir-137-P2  Cte-Mir-137  Dan-Mir-137  Dme-Mir-137  Dmo-Mir-137  Dno-Mir-137-P1-v1  Dno-Mir-137-P1-v2  Dpu-Mir-137  Dre-Mir-137-P1a-v1  Dre-Mir-137-P1a-v2  Dre-Mir-137-P1b-v1  Dre-Mir-137-P1b-v2  Efe-Mir-137-P4  Efe-Mir-137-P5  Efe-Mir-137-P6  Efe-Mir-137-P7  Efe-Mir-137-P8  Efe-Mir-137-P9  Efe-Mir-137-P10  Ete-Mir-137-P1-v1  Ete-Mir-137-P1-v2  Gga-Mir-137-P1-v1  Gga-Mir-137-P1-v2  Hme-Mir-137  Hsa-Mir-137-P1-v1  Hsa-Mir-137-P1-v2  Isc-Mir-137  Lan-Mir-137  Lgi-Mir-137  Mdo-Mir-137-P1-v1  Mdo-Mir-137-P1-v2  Mdo-Mir-137-P2  Mml-Mir-137-P1-v1  Mml-Mir-137-P1-v2  Mmu-Mir-137-P1-v1  Mmu-Mir-137-P1-v2  Oan-Mir-137-P1-v1  Oan-Mir-137-P1-v2  Oan-Mir-137-P2  Ocu-Mir-137-P1-v1  Ocu-Mir-137-P1-v2  Pfl-Mir-137-v1  Pfl-Mir-137-v2  Pmi-Mir-137-v1  Pmi-Mir-137-v2  Rno-Mir-137-P1-v1  Rno-Mir-137-P1-v2  Sha-Mir-137-P1-v1  Sha-Mir-137-P1-v2  Sha-Mir-137-P2  Sko-Mir-137  Spu-Mir-137  Sto-Mir-137-P1  Tca-Mir-137-v1  Tca-Mir-137-v2  Tgu-Mir-137-P1-v1  Tgu-Mir-137-P1-v2  Xtr-Mir-137-P1c  Xtr-Mir-137-P1d  Xtr-Mir-137-P1e 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold313: 186097-186155 [-]
Precursor
(pre-Mir +30nt flank)
GUCUGUGUUUAGAAUGGCUGAAGCAGCAAAAGGUAUUCUCCGGUAAUGACAUAGUGCAUUGAAAGCUGUUAUUGCUUGAGAAUACAAAUUGUUGUCCGGCCAACAAACUGUUCAACAGU
Get precursor sequence
Structure
        10           20        30        40        50         
GUCUGUGUUUAGAAUGG---|  AA       AAG        C          UAGUGCA 
                    CUG  GCAGCAA   GUAUUCUC GGUAAUGACA       \
                    GGC  UGUUGUU   CAUAAGAG UCGUUAUUGU       U
UGACAACUUGUCAAACAACC^  C-       AAA        U          CGAAAGU 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-137_5p*

MirBase accessionMIMAT0021499
Sequence
0- AGGUAUUCUCCGGUAAUGACA -21
Get sequence
Mature sequence

Asu-Mir-137_3p

MirBase accessionMIMAT0021500
Sequence
38- UUAUUGCUUGAGAAUACAAAU -59
Get sequence