
MirGeneDB ID


Family name MIR-137 (all species)
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-137-2
Paralogues Dre-Mir-137-P1a-v1  Dre-Mir-137-P1a-v2  Dre-Mir-137-P1b-v1 
Orthologues Aca-Mir-137-P1-v1  Aca-Mir-137-P1-v2  Ami-Mir-137-P1-v1  Ami-Mir-137-P1-v2  Asu-Mir-137  Bfl-Mir-137  Bta-Mir-137-P1-v1  Bta-Mir-137-P1-v2  Cbr-Mir-137  Cel-Mir-137  Cfa-Mir-137-P1-v1  Cfa-Mir-137-P1-v2  Cgi-Mir-137  Cli-Mir-137-P1-v1  Cli-Mir-137-P1-v2  Cpi-Mir-137-P1-v1  Cpi-Mir-137-P1-v2  Cte-Mir-137  Dan-Mir-137  Dme-Mir-137  Dmo-Mir-137  Dno-Mir-137-P1-v1  Dno-Mir-137-P1-v2  Dpu-Mir-137  Ete-Mir-137-P1-v1  Ete-Mir-137-P1-v2  Gga-Mir-137-P1-v1  Gga-Mir-137-P1-v2  Hme-Mir-137  Hsa-Mir-137-P1-v1  Hsa-Mir-137-P1-v2  Isc-Mir-137  Lan-Mir-137  Lgi-Mir-137  Mdo-Mir-137-P1-v1  Mdo-Mir-137-P1-v2  Mml-Mir-137-P1-v1  Mml-Mir-137-P1-v2  Mmu-Mir-137-P1-v1  Mmu-Mir-137-P1-v2  Oan-Mir-137-P1-v1  Oan-Mir-137-P1-v2  Ocu-Mir-137-P1-v1  Ocu-Mir-137-P1-v2  Rno-Mir-137-P1-v1  Rno-Mir-137-P1-v2  Sha-Mir-137-P1-v1  Sha-Mir-137-P1-v2  Sko-Mir-137  Spu-Mir-137  Sto-Mir-137-P1  Tgu-Mir-137-P1-v1  Tgu-Mir-137-P1-v2 
Node of Origin (locus) D. rerio
Node of Origin (family) Bilateria
Genome context
chr24: 30352646-30352705 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-137-P1b-v2)
Mir-137-P1b-v1 chr24: 30352646-30352704 [+] UCSC Ensembl
Mir-137-P1b-v2 chr24: 30352646-30352705 [+] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30        40        50         
GUUUCCCUCUAUAAAGG---|          UG   G           UG A    ACGGC 
                    ACUCUCUUCGG  ACG GUAUUCUUGGG  G UAAU     U
                    UGAGAGGAGCU  UGC CAUAAGAAUUC  U AUUG     C
CGAGAGAGCGGCGGCUGUAC^          GA   G           GU -    UUGCU 
.       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence


MirBase accessionMIMAT0031972
Get sequence
Mature sequence


MirBase accessionMIMAT0001834
Get sequence
Validated targets TargetScanFish: dre-miR-137