MirGeneDB

Gene name

Hme-Mir-317

Family name MIR-317 (all species)
MiRBase ID
Paralogues
Orthologues Aae-Mir-317-P8  Aae-Mir-317-P9  Bge-Mir-317  Cgi-Mir-317-P1  Cgi-Mir-317-P2  Cte-Mir-317  Dan-Mir-317  Dme-Mir-317  Dmo-Mir-317  Dpu-Mir-317  Efe-Mir-317-P5  Efe-Mir-317-P6  Efe-Mir-317-P7  Isc-Mir-317  Lan-Mir-317-P10  Lan-Mir-317-P11  Lgi-Mir-317  Tca-Mir-317 
Node of Origin (gene) Protostomia
Node of Origin (family) Protostomia
Genome context
(Hmel_1)
HE667979: 27841-27903 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAUUAAGAAGAUGACGGGCUACCGAACGACCGGGUGCCACGCUGUGCUCUCUCGGUGUUACUGGUGAGUGAACACAGCUGGUGGUAUCUCAGUUGUUCCUUAGUUCUCCCGCAAUGCAGCUAC
Get precursor sequence
Structure
        10          20        30         40          50         
AAUUAAGAAGAUGACGG--    CC       C-         --|     C  U  CGGUGU 
                   GCUA  GAACGAC  GGGUGCCAC  GCUGUG UC CU      U
                   UGAU  CUUGUUG  UCUAUGGUG  CGACAC AG GA      A
CAUCGACGUAACGCCCUCU    UC       AC         GU^     A  U  GUGGUC 
 120       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Mir-317_5p*

MirBase accessionNone
Sequence
0- CGGGUGCCACGCUGUGCUCUCU -22
Get sequence
Mature sequence

Hme-Mir-317_3p

MirBase accessionNone
Sequence
38- UGAACACAGCUGGUGGUAUCUCAGU -63
Get sequence
Seed sequenceGAACACA