MirGeneDB

MirGeneDB ID

Lan-Mir-317-P10

Family name MIR-317 (all species)
Seed GAACACA
Species Lingula (Lingula anatina)
MiRBase ID
Paralogues Lan-Mir-317-P11 
Orthologues Bge-Mir-317  Cte-Mir-317  Dan-Mir-317  Dme-Mir-317  Dmo-Mir-317  Dpu-Mir-317  Hme-Mir-317  Isc-Mir-317  Lgi-Mir-317  Tca-Mir-317 
Node of Origin (locus) L. anatina
Node of Origin (family) Protostomia
Genome context
(LinAna_1.0)
LFEI01002950: 930-993 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAUGGAGGACAGUUUAUUCUCAUGAAGACAAAGGUAUCACUGUGUGUUCGCAGUUUUAUGAAAACUCCUGUGAACACAGCUGGUGGUAUCUCUAUCUCCAUGAUGACUUGCAACUUUAGGAGAA
Get precursor sequence
Structure
        10          20        30        40          50        60
AAUGGAGGACAGUUUAU-  -     A   CAA          - -|         GUUUUAU 
                  UC UCAUG AGA   AGGUAUCACU G UGUGUUCGCA       G
                  AG AGUAC UCU   UCUAUGGUGG C ACACAAGUGU       A
AAGAGGAUUUCAACGUUC  U     C   AUC          U G^         CCUCAAA 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To To
Star sequence

Lan-Mir-317-P10_5p*

MirBase accessionNone
Sequence
0- AAGGUAUCACUGUGUGUUCGCA -22
Get sequence
Mature sequence

Lan-Mir-317-P10_3p

MirBase accessionNone
Sequence
40- UGAACACAGCUGGUGGUAUCUCUA -64
Get sequence