MirGeneDB

Gene name

Dre-Mir-27-P2a

Family name MIR-27 (all species)
MiRBase ID dre-mir-27d
Paralogues Dre-Mir-27-P1  Dre-Mir-27-P2b  Dre-Mir-27-P3a  Dre-Mir-27-P3b 
Orthologues Aca-Mir-27-P2  Ami-Mir-27-P2  Bta-Mir-27-P2  Cfa-Mir-27-P2  Cli-Mir-27-P2  Cpi-Mir-27-P2  Cpo-Mir-27-P2  Dno-Mir-27-P2  Ete-Mir-27-P2  Gga-Mir-27-P2  Hsa-Mir-27-P2  Mdo-Mir-27-P2  Mml-Mir-27-P2  Mmu-Mir-27-P2  Ocu-Mir-27-P2  Rno-Mir-27-P2  Sha-Mir-27-P2  Tgu-Mir-27-P2  Xtr-Mir-27-P2 
Node of Origin (gene) Teleostei
Node of Origin (family) Vertebrata
Genome context
(danRer11_plustraces)
chr10: 15954740-15954804 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-27-P2a)
Mir-23-P2a chr10: 15954588-15954651 [+] UCSC Ensembl
Mir-24-P2a chr10: 15960848-15960904 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCAGCAAAACAACUCAUUCUGAGCGGGUGCAGAGCUUGGCUGAUUGGUGAACGUGCAUGGCUUGUGUUUUUGUUCACAGUGGCUAAGUUCUUCACCCGAAAAGAAAAUAAGAAAGUGCAGUUAU
Get precursor sequence
Structure
        10          20        30        40        50        60   
ACCAGCAAAACAACUCA--|   GAG      C            AUUG       UGCAUGGC 
                   UUCU   CGGGUG AGAGCUUGGCUG    GUGAACG        \
                   AAGA   GCCCAC UCUUGAAUCGGU    CACUUGU        U
UAUUGACGUGAAAGAAUAA^   AAA      U            GA--       UUUUGUGU 
   120       110       100        90        80          70
Deep sequencing
Go to detailed chart
CommentThe Drosha cut is 1 nt longer relative to the other gnathostomes
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-27-P2a_5p*

MirBase accessionNone
Sequence
0- CAGAGCUUGGCUGAUUGGUGAACG -24
Get sequence
Mature sequence

Dre-Mir-27-P2a_3p

MirBase accessionMIMAT0001799
Sequence
43- UUCACAGUGGCUAAGUUCUUCA -65
Get sequence
Seed sequenceUCACAGU
Validated targets TargetScanFish: dre-miR-27d