MirGeneDB

MirGeneDB ID

Dre-Mir-199-P3-v3

Family name MIR-199 (all species)
Seed AGUAGUC
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-199-1
Paralogues Dre-Mir-199-P1-v1  Dre-Mir-199-P1-v2  Dre-Mir-199-P1-v3  Dre-Mir-199-P2-v1  Dre-Mir-199-P2-v2  Dre-Mir-199-P2-v3  Dre-Mir-199-P3-v1  Dre-Mir-199-P3-v2 
Orthologues Aca-Mir-199-P3-v1  Aca-Mir-199-P3-v2  Aca-Mir-199-P3-v3  Ami-Mir-199-P3-v1  Ami-Mir-199-P3-v2  Ami-Mir-199-P3-v3  Bta-Mir-199-P3-v1  Bta-Mir-199-P3-v2  Bta-Mir-199-P3-v3  Cfa-Mir-199-P3-v1  Cfa-Mir-199-P3-v2  Cfa-Mir-199-P3-v3  Cli-Mir-199-P3-v1  Cli-Mir-199-P3-v2  Cli-Mir-199-P3-v3  Cpi-Mir-199-P3-v1  Cpi-Mir-199-P3-v2  Cpi-Mir-199-P3-v3  Cpo-Mir-199-P3-v1  Cpo-Mir-199-P3-v2  Cpo-Mir-199-P3-v3  Dno-Mir-199-P3-v1  Dno-Mir-199-P3-v2  Dno-Mir-199-P3-v3  Ete-Mir-199-P3-v1  Ete-Mir-199-P3-v2  Ete-Mir-199-P3-v3  Gga-Mir-199-P3-v1  Gga-Mir-199-P3-v2  Gga-Mir-199-P3-v3  Hsa-Mir-199-P3-v1  Hsa-Mir-199-P3-v2  Hsa-Mir-199-P3-v3  Mdo-Mir-199-P3-v1  Mdo-Mir-199-P3-v2  Mdo-Mir-199-P3-v3  Mml-Mir-199-P3-v1  Mml-Mir-199-P3-v2  Mml-Mir-199-P3-v3  Mmu-Mir-199-P3-v1  Mmu-Mir-199-P3-v2  Mmu-Mir-199-P3-v3  Oan-Mir-199-P3-v1  Oan-Mir-199-P3-v2  Oan-Mir-199-P3-v3  Ocu-Mir-199-P3-v1  Ocu-Mir-199-P3-v2  Ocu-Mir-199-P3-v3  Rno-Mir-199-P3-v1  Rno-Mir-199-P3-v2  Rno-Mir-199-P3-v3  Sha-Mir-199-P3-v1  Sha-Mir-199-P3-v2  Sha-Mir-199-P3-v3  Sto-Mir-199-P3-v1  Sto-Mir-199-P3-v2  Sto-Mir-199-P3-v3  Tgu-Mir-199-P3-v1  Tgu-Mir-199-P3-v2  Tgu-Mir-199-P3-v3  Xtr-Mir-199-P3-v1  Xtr-Mir-199-P3-v2  Xtr-Mir-199-P3-v3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr20: 14875474-14875534 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-199-P3-v3)
Mir-199-P3-v1 chr20: 14875474-14875534 [+] UCSC Ensembl
Mir-199-P3-v2 chr20: 14875474-14875534 [+] UCSC Ensembl
Mir-214-v1 chr20: 14877660-14877721 [+] UCSC Ensembl
Mir-214-v2 chr20: 14877660-14877721 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGGGCUGGAACUAUCUCCUGCUCCGUCAUCCCAGUGUUCAGACUACCUGUUCAGGAUCAUACUGGUGUACAGUAGUCUGCACAUUGGUUAGACUGUGCAUGGACUCCCGGCGAUGAGGAA
Get precursor sequence
Structure
        10          20        30        40        50        60
GAGGGCUGGAACUAUCU-  -|  UCC   AUC       U        C   UCAGGAUC 
                  CC UGC   GUC   CCAGUGU CAGACUAC UGU        A
                  GG ACG   CAG   GGUUACA GUCUGAUG ACA        U
AAGGAGUAGCGGCCCUCA  U^  UGU   AUU       C        -   UGUGGUCA 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-199-P3-v3_5p*

MirBase accessionMIMAT0001277
Sequence
0- CCCAGUGUUCAGACUACCUGUU -22
Get sequence
Validated targets TargetScanFish: dre-miR-199
Mature sequence

Dre-Mir-199-P3-v3_3p

MirBase accessionMIMAT0003155
Sequence
40- CAGUAGUCUGCACAUUGGUUA -61
Get sequence