MirGeneDB

Gene name

Dno-Mir-202

Family name MIR-202 (all species)
MiRBase ID dno-mir-202
Paralogues
Orthologues Aca-Mir-202  Ami-Mir-202  Bta-Mir-202  Cfa-Mir-202  Cli-Mir-202  Cpi-Mir-202  Cpo-Mir-202  Dre-Mir-202  Ete-Mir-202  Gga-Mir-202  Hsa-Mir-202  Mml-Mir-202  Mmu-Mir-202  Ocu-Mir-202  Rno-Mir-202  Sha-Mir-202  Xtr-Mir-202-P1  Xtr-Mir-202-P2 
Node of Origin (gene) Teleostei
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH563543: 93903-93960 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCCGCCGGACCGCGGCUCGUCGUUCCCUCUUCCUAUGCAUAUACUUCUUCGAGGGUCUGGCCUGAAGAGGUGUAGGGCAUGGGAAAAGGGGGCGGCGAGGGCCCCUCCACGACGCGG
Get precursor sequence
Structure
        10          20        30        40         50        
GCCCGCCGGACCGCGGC--            C         A-|          GAGGGU 
                   UCGUCGUUCCCU UUCCUAUGC  UAUACUUCUUC      \
                   AGCGGCGGGGGA AAGGGUACG  AUGUGGAGAAG      C
GGCGCAGCACCUCCCCGGG            A         GG^          UCCGGU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Mir-202_5p

MirBase accessionMIMAT0047742
Sequence
0- UUCCUAUGCAUAUACUUCUUC -21
Get sequence
Seed sequenceUCCUAUG
Star sequence

Dno-Mir-202_3p*

MirBase accessionMIMAT0047743
Sequence
36- AGAGGUGUAGGGCAUGGGAAAA -58
Get sequence