MirGeneDB

Gene name

Tca-Mir-3849

Family name MIR-3849 (all species)
MiRBase ID tca-mir-3849
Paralogues
Orthologues
Node of Origin (gene) T. castaneum
Node of Origin (family) T. castaneum
Genome context
(Tcas5.2)
LG5: 5505646-5505710 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UCAUUUUGUUGUCGUAACUGUUCGAAAUGCUGACAUUUUAACCAUAGUGCUGUUGUUUAUAUUCAAAUUAAUAGCAUUGUGUUGGAAAUGUCGUCUUUUCGAACAAACUAGCACCGAUUAAGUUA
Get precursor sequence
Structure
        10          20        30        40        50        60  
UCAUUUUGUUGUCGUAAC--|        UGC         AAC           UGUUUAUA 
                    UGUUCGAAA   UGACAUUUU   CAUAGUGCUGU        \
                    ACAAGCUUU   GCUGUAAAG   GUGUUACGAUA        U
AUUGAAUUAGCCACGAUCAA^        UCU         GUU           AUUAAACU 
   120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Mature sequence

Tca-Mir-3849_5p

MirBase accessionMIMAT0018752
Sequence
0- UGACAUUUUAACCAUAGUGCUGU -23
Get sequence
Seed sequenceGACAUUU
Star sequence

Tca-Mir-3849_3p*

MirBase accessionMIMAT0018753
Sequence
42- AGCAUUGUGUUGGAAAUGUCGUC -65
Get sequence