MirGeneDB

Gene name

Pfl-Mir-2009

Family name MIR-2009 (all species)
MiRBase ID
Paralogues
Orthologues Pmi-Mir-2009  Spu-Mir-2009 
Node of Origin (gene) Ambulacraria
Node of Origin (family) Ambulacraria
Genome context
(Pfl)
LD355980.1: 422987-423047 [+]
Precursor
(pre-Mir +30nt flank)
GCAUGAUGCUUCUCUUUGGCAGUGUUUUGCGGUUUUUGUGGAACAACUCACAGAAACUUUCCAACUAUGUGAGUUGUCCCACAAAGAACACAGAAUGCUGUGGCUUACAUCUCGACAACUG
Get precursor sequence
Structure
        10          20        30        40        50          
GCAUGAUGCUUCUCUUUG--|          CGG         A          GAAACUU 
                    GCAGUGUUUUG   UUUUUGUGG ACAACUCACA       \
                    UGUCGUAAGAC   AGAAACACC UGUUGAGUGU       U
GUCAACAGCUCUACAUUCGG^          ACA         C          AUCAACC 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-2009_5p* (predicted)

MirBase accessionNone
Sequence
0- GGUUUUUGUGGAACAACUCACA -22
Get sequence
Mature sequence

Pfl-Mir-2009_3p

MirBase accessionNone
Sequence
39- UGAGUUGUCCCACAAAGAACAC -61
Get sequence
Seed sequenceGAGUUGU