MirGeneDB

Gene name

Gga-Mir-124-P4-v2

Family name MIR-124 (all species)
MiRBase ID gga-mir-124b
Paralogues Gga-Mir-124-P1-v1  Gga-Mir-124-P1-v2  Gga-Mir-124-P2-v1  Gga-Mir-124-P2-v2  Gga-Mir-124-P3-v1  Gga-Mir-124-P3-v2  Gga-Mir-124-P4-v1 
Orthologues Aae-Mir-124  Aca-Mir-124-P4-v1  Aca-Mir-124-P4-v2  Ami-Mir-124-P4-v1  Ami-Mir-124-P4-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cpi-Mir-124-P4-v1  Cpi-Mir-124-P4-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Dre-Mir-124-P4-v1  Dre-Mir-124-P4-v2  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Tca-Mir-124 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(galGal5)
23: 2223499-2223556 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-124-P4-v2)
Mir-124-P4-v1 23: 2223499-2223557 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGCGCUCCCCAGCCAUCAGCCCCAGCGUUUUGUGUUCACUGCAGACCUUGAUUUAAUGUCACACGAUUAAGGCACGCAGUGAAUGCCAAAGUUUGGGGCAGCCUGGGCUGGGGGCUGC
Get precursor sequence
Structure
        10         20        30        40        50         
CGCGCUCCCCAGCCAUCA-|      CG   U           AGA        UAAUG 
                   GCCCCAG  UUU GUGUUCACUGC   CCUUGAUU     \
                   CGGGGUU  AAA CGUAAGUGACG   GGAAUUAG     U
CGUCGGGGGUCGGGUCCGA^      UG   C           CAC        CACAC 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-124-P4-v2_5p* (predicted)

MirBase accessionNone
Sequence
0- UGUGUUCACUGCAGACCUUGAUU -23
Get sequence
Mature sequence

Gga-Mir-124-P4-v2_3p

MirBase accessionMIMAT0001174
Sequence
36- UUAAGGCACGCAGUGAAUGCCA -58
Get sequence
Seed sequenceUAAGGCA
Validated targets TargetScanVert: gga-miR-124b
miRDB: MIMAT0001174