MirGeneDB

Gene name

Dan-Mir-927-P1

Family name MIR-927 (all species)
MiRBase ID
Paralogues
Orthologues Aae-Mir-927-P1  Bge-Mir-927-P1  Dme-Mir-927-P1  Dmo-Mir-927-P1  Hme-Mir-927-P1  Tca-Mir-927-P1 
Node of Origin (gene) Pterygota
Node of Origin (family) Pterygota
Genome context
(Dana_caf1)
scaffold_13250: 3108686-3108747 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUAGAUCAUAAAAAAAGGGUAUUGUGGAGUUUUAGAAUUCCUACGCUUUACCGUUGCAUAUGAAAUUAGGCAAAGCGUUUGGAUUCUGGAACCCUAUGUAUUCAUUUUUAUAAUGUGUUUUC
Get precursor sequence
Structure
        10           20        30        40        50        60
GUAGAUCAUAAAAAAAG---|    UGU  A            CU       A  GUUGCAU 
                    GGUAU   GG GUUUUAGAAUUC  ACGCUUU CC       A
                    UUAUG   CC CAAGGUCUUAGG  UGCGAAA GG       U
CUUUUGUGUAAUAUUUUUAC^    UAU  -            UU       C  AUUAAAG 
120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Mature sequence

Dan-Mir-927-P1_5p

MirBase accessionNone
Sequence
0- UUUAGAAUUCCUACGCUUUACC -22
Get sequence
Seed sequenceUUAGAAU
Co-mature sequence

Dan-Mir-927-P1_3p

MirBase accessionNone
Sequence
40- CAAAGCGUUUGGAUUCUGGAAC -62
Get sequence
Seed sequenceAAAGCGU