MirGeneDB

Gene name

Tgu-Mir-1641

Family name MIR-1641 (all species)
MiRBase ID tgu-mir-1641
Paralogues
Orthologues Aca-Mir-1641  Ami-Mir-1641  Cli-Mir-1641  Cpi-Mir-1641  Gga-Mir-1641 
Node of Origin (gene) Diapsida
Node of Origin (family) Diapsida
Genome context
(taeGut3.2.4)
3: 24223295-24223353 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAAUAACAACGUCGAUGCAGGGCAUUUCCUGAGGAUUAAUGACUGUCUGGGGUCAUCAUCUCCUCCCAGUUAGUUAUUAAUCUCCAGGAAAUACUCUGUGCCUUGAUCAUUAUUGCUU
Get precursor sequence
Structure
        10          20        30        40        50         
GCAAUAACAACGUCGAU--|     C        AG            U     GUCAUC 
                   GCAGGG AUUUCCUG  GAUUAAUGACUG CUGGG      \
                   UGUCUC UAAAGGAC  CUAAUUAUUGAU GACCC      A
UUCGUUAUUACUAGUUCCG^     A        CU            U     UCCUCU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-1641_5p

MirBase accessionMIMAT0025400
Sequence
0- UGAGGAUUAAUGACUGUCUGGG -22
Get sequence
Seed sequenceGAGGAUU
Star sequence

Tgu-Mir-1641_3p* (predicted)

MirBase accessionNone
Sequence
37- CAGUUAGUUAUUAAUCUCCAGG -59
Get sequence