MirGeneDB

MirGeneDB ID

Dre-Mir-456

Family name MIR-456 (all species)
Seed AGGCUGG
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-456
Paralogues
Orthologues Aca-Mir-456  Ami-Mir-456  Cli-Mir-456  Cpi-Mir-456  Gga-Mir-456  Sto-Mir-456  Tgu-Mir-456  Xtr-Mir-456 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr17: 22827076-22827137 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUUGCUGAUUUCCGCUGGCUGGUUGUGUGUGCAGGCAUCUUUCCAGUCUACAUGUGGAUCCAGGAGUCUGCAGGCUGGUUAGAUGGUUGUCACGUACCCAGCAAACAUCACAGUGUUUUAUU
Get precursor sequence
Structure
        10           20        30        40        50        60
GUUGCUGAUUUCCGCUG---|    U      U    G     UU       A  UGUGGAU 
                    GCUGG UGUGUG GCAG CAUCU  CCAGUCU CA       C
                    CGACC AUGCAC UGUU GUAGA  GGUCGGA GU       C
UUAUUUUGUGACACUACAAA^    C      -    G     UU       C  CUGAGGA 
120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-456_5p*

MirBase accessionNone
Sequence
0- GCAGGCAUCUUUCCAGUCUACA -22
Get sequence
Mature sequence

Dre-Mir-456_3p

MirBase accessionMIMAT0001882
Sequence
40- CAGGCUGGUUAGAUGGUUGUCA -62
Get sequence
Validated targets TargetScanFish: dre-miR-456